|
THE BERNHARD FAMILY IN "SWITZERLAND" CGATGCAAACACACACACACACACACACACACACAC
DIE BERNHARD FAMILIE SCHWEIZ /
BASEL GGATGCAAACACACACACACAAACACACACACACAC
ACACACACACACACACACACATTTTCATGGGGCAGGGAGGAAATGTAATGCATGAAATATCCAAGAAAAACAA
AATTTAAAAAATAGAAAAAGACCTGTAGGTGTTGGCAGTATAACCTCTATATTGCTGTTTGAGACTGGGTATT
NCGCTTCCANCGGGAACCTGTCGTGCCACTCATAAGGGNGGGCANNTTCTTCCATGGAGGGAACTNTCCTNCC
TGCTGANNNNCNNGCNCTGTTCCANGGAACTTNTGTTATTTATTTATTTNTGCCTTCTCAGTGTTAGATTACA
FAMILY@BERNHARDS.NET TGGTGGGTACGAGCTGGTCATCGTGAATTGTATCCGCTCACAANTCACACAA
www.bernhards.net
uses plainsequence format +N,a sequence in plain format
may contain only IUPAC
characters and spaces, no numbers! CCACTNAGCTNACTC
A = adenine , C = cytosine , G = guanine , T = thymine N = A G C T [any
]
___
The District
of the Upper Engadine
For the geographer the Upper Engadine begins at the
highest point of the Maloja pass, from a historical-political
point of view, however, only at the boundary where the district
of Bergell begins, which is a line north of Isola running
across the lake of Sils. From this line the district of the
Upper Engadine comprises the whole valley of the Inn with its
tributaries as far as Punt ota, the High Bridge, between
Cinuoschel and Brail. It includes the political communes of
Bever, Celerina/Schlarigna, Madulain, La Punt-Chamues-ch,
Pontresina, Samedan, St.Moritz, S-chanf,
Sils i.E., Silvaplana,
and Zuoz.
The name Engadine, Romansh Engiadina, which appears in
the oldest documents as Endena and Eniatina, is derived from
the antique river name Enus, the Inn; the form Eniatina is
derived from Eniates, meaning - the people living in the Inn
valley.
The importance of the geographical position is evident
when one remembers that four pass routes lead to the Upper
Engadine: Albula, Bernina, Julier, and Maloja.
A Bronz Age settlement has been proved by several
finds, the most important of which is the well at St. Moritz.
The Romans used the Maloja and Julier passes. This is
proved not only by the pillars of the Roman sanctuary on the
Julier pass, but also by the four Roman votive altars found
near Sils Baselgia in 1964.
In documents the Upper Engadine is first mentioned in
the imperial register in Currtien dating from the first half
of the 9th century. It formed its own Ministerium called
Endena. After the extinction of the upper Rhaetian duchy in
the 11th century, the sovereignty of the whole valley passed to
the Bishop probably by royal bestowment. It is a fact that the
Bishop of Chur was already in possession of sovereign rights in
1137/39 when he acquired extensive land property in Swabia from
the Dukes Ulrich and Adalbert of Gamertingen.
At the end of the 13th century the members of the
Planta family at Zuoz held the sovereign rights of the Bishop.
At an early date, about the middle of the 12th century, the
market corporation of the people in the valley appears as an
independent power, which soon gained political importance. In
1367 "Thomas Planta, magistrate, and his whole family as well
as the commune in the Upper Engadine" sealed the treaty with
the League of God's House, which shows that the commune could
act independently.
After the middle of the 14th century a subdivision of
the whole commune was made into "Sur funtauna merla" and "Suot
funtauna merla", at a source between Bever and La Punt. This
division became officially recognised in 1438 when the two
lower courts were given the right to deal with minor matters,
which meant that they were practically independent
jurisdictions within the High Court of the Upper Engadine.
Toward the middle of the 16th century the development
to independence of the eleven villages was formally settled by
giving them the right to have their own statutes. This also
meant that the present-day boundaries of the communes were
fixed. They were later recognised by the bill of 1851.
Philipp Gallicius preached the new faith in the Upper
Engadine, but at first the Reformation made little headway
because of the influence of the Bishop and the policy of the
Planta and Travers families. It was not until Johann Travers
of Zuoz took a definite stand on the side of the Reformation
that the whole territory accepted it.
The geographical importance of the Julier, Maloja, and
the Bernina passes, as well as the road through the valley,
brought the Upper Engadine many drawbacks during times of
upheaval such as the wars in the Grisons. On the other hand
the transport corporations and the local trade benefited a
great deal from the traffic. Service abroad for foreign armies
was also of economic importance, not only because of the money
that came into the country but also because of the experience
and know-how that those who had worked in foreign countries
brought back with them. Many of them earned their living as
confectioners or owners of coffee houses.
Since the unique beauty of the landscape of the Upper
Engadine was discovered by the modern tourist, the hotel trade
has become one of the most important factors in the economy of
the Upper Engadine.
The language of the Upper Engadine is Ladin, a regional
dialect of Romansh, which is also written.
Personalities from the District of the Upper Engadine:
Johann Travers (1483-1563) from Zuoz. He made
humanistic studies at several universities abroad. When he
returned home he bacame the steward of the Bishop. In the
battle of Marignano he was the leader of a company. Above all
he made himself a name as a leader in the wars against the
Castellan of Musso. He was Captian General of the Valtellina
and was no less than 13 times magistrate of the Upper
Engadine. His acceptace of the new belief was the decisive
factor in introducing the Reformation into the Upper Engadine.
He is not only considered to be one of the most eminent
statesmen of his time, but also became the founder of the Ladin
language and in some way also the founder of the written form
of Romansh because he wrote the chronicle of the first Musso
war and also his spiritual plays in Romansh rhymes.
Georg Jenatsch (1596-1639) from Samedan. After he had
been accepted in the Rhaetian synod he was a preacher in the
Grisons and the Valtellina. In the wars of the Grisons he
played an important part against the Spanish party, especially
in the murder of Pompeius Planta, the leader of the
Spanish-Austrian party. In 1635 he was the right hand of Duke
Henri de Rohan, who was in the service of Richelieu and who
took the Valtellina from the Spanish. When Jenatsch saw that
he was deceived in his hope of the Valtellina being given back
to the Grisons by the French, he became an ally of Spain and
Austria and in May 1637 forced the French to leave the
Grisons. In January 1635 he converted to Catholicism. In 1639
he became victim of a plot a Chur. He is one of the best-known
and at the same time most controversial personalities in the
history of the Grisons.
District Coat of Arms: Azure, portrait of St. Luzius
with crown gold and halo. Blazonry: St.
Luzius, patron of the
old church of S.Lucii at Zuoz, is on the traditional seal of
the court of the Upper Engadine. The blue colour goes back to
the coat of arms of the Barons of Gamertingen, from whom the
Bishop took over the sovereignty of the Upper Engadine.
District colours: blue-yellow.
END TGGAT
SEQ © "THE BERNHARDS FAMILY" 2002, BASLE SWITZERLAND CTCGACAAAT
THE INDIVIDUAL SEQUENCES ARE UNDER © OF THE INDIVIDUAL OWNERS CREDITED
AB
|